haydenrosejackson1 haydenrosejackson1

15-10-2020
Biology

contestada

What is the complementary strand for this segment of DNA? I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA Ill give u 15 point pls answer class=

Respuesta :

zayveionbrown zayveionbrown

15-10-2020

I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC

Answer Link

Otras preguntas

How do you write an interval notation on quadratic inequality?

Two questions someone interested in psychology and the study of the individual might ask about the topicDoes the type a vehicle we drive tell who we are?Does a

Which principle is used to make hydraulic machines work

Algebra I, Semester B Syllabus..

Control System Question:

The main purpose of punishment in the nineteenth and twentieth centuries was to deter people from committing crimes.’ How far do you agree? Explain your answer.

rom declining European imperial powers. Match each of the countries below to the imperial power from which they sought independence.

What are two possible transformations that together could have been used to create the image of (mc022-1 ) ---> A' from A? (<-- the graph (see picture))

If 7 more than twice a number is 5 less than three times the same number, what is the number?

If one root of It + 13 x + k = 0 is the reciprocal of the other root, then find value of k. an AABO.