haydenrosejackson1
haydenrosejackson1 haydenrosejackson1
  • 15-10-2020
  • Biology
contestada

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA Ill give u 15 point pls answer class=

Respuesta :

zayveionbrown zayveionbrown
  • 15-10-2020
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
Answer Link

Otras preguntas

Ramon applied to the state university in the city where he lives, but he was denied admission. What should he do now? A. Change his mind about graduating and d
Prove the identity. (steps needed to prove the identify aka= sin = 1/cscx) its like a puzzle and im confused sec(-x)-sin(-x)tan(-x)=cosx
Hi how are you today I have some questions that I don’t understand from alef website can you give me explanation please
(25pts) Due soon! Help!
PLEASE HELP RIGHT AWAY
1. In 3–5 sentences, discuss how social media influences a teenager’s self-esteem. Real answers please! will give brainliest!
The space shuttle orbits 340km above the surface of the earth.What is the gravitational force on a 9.0kg sphere inside the space shuttle? The sphere floats arou
How does multiplying a vector by a scalar value of -pi change the vector? a) the vector will change direction and increase in magnitude. b) the vector will cha
Liquids that dissolve freely in one another in any proportion
What is 348,401 as a scientific notation