lewismaya16 lewismaya16

14-11-2014
Mathematics

contestada

A powdered drink mix calls for a ratio of powder to water of 1 : 8 if there are 32 cups of powder, how many total cups of water are needed ? Explain your reasoning

Respuesta :

g00stav0 g00stav0

14-11-2014

1:8=32:?
32x8 is 256
256 cups of water

Answer Link

Otras preguntas

which have the most kinetic energy? a puck traveling at 10 mph,a player traveling at 10 mph, a puck traveling at 40 mph, a player traveling at 40 mph

For the growth curve to continue increasing, which of these must occur?

Please help. It'd be much appreciated :)

A red capital L over your home on a wether map probably indicates what?

in peter's garden, 3/4 of the flowers are tulips. of the tulips, 2/3 are yellow. what fraction of the flowers in peter's garden are yellow tulips? draw a model

PLS HELP ME ASAP ON 5! THANK YOU SO MUCH!! (Read direction carefully pls ^^) (Brainliest will be given) (Random answers gets moderated.)

Brainly who were the big three? the leaders of france, great britain, and italy the leaders of the soviet union, great britain, and the united states the leader

Suppose that y varies directly as x, and that y = 12 when x = 3. When x = 10, y =

what is the answer to both the questions??

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg