ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

although insect wings are constructed differently than bird wings, they do share a similar overall shape. why?

Which has a mismatch between subject and modifier? Though sleeping, my dream was so realistic that I thought I was awake. Though sleeping, I had such a realis

which one would have more gravitational mass? one kilogram of iron dropped from 200 meters height or one kilogram of paper on the ground?

the temperature of cosmic background radiation is approximately -3 degrees Celsius -270 degrees Celsius 0 degrees Celsius or 270 degrees Celsius

Choose the sentence that correctly uses ellipses to replace the underlined words. Artist Rene Magritte's humble beginnings included "nonglamorous jobs such as"

In poetry and fiction, the main reason for using vivid words is to

extracelluar fluid is also called

True or false Isolationist is a national policy of abstaining from political or economic relations with other countries.

. Why did President Truman believe that political change would come to the Soviet Union? a. the failures of the Soviet nuclear program b. the appeal of freedo

The thalamus sends auditory information to the primary visual cortex. true or False