ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

Tribes such as the Algonquian, Cherokee, and Iroquois lived in the Eastern Woodlands. Where are these woodlands located? on the eastern slopes of the Rocky Moun

What is 8^1/2 in simplest form

Plz show me how to work this out

Which additional words in the sentence should be capitalized? The island of santa catalina is off the coast of california. Choose all answers that are correct.

how has the role of women changed in the past one hundred years?

What raw materials did Europeans seize in West Africa?

Which of the following is true about new foreign treaties? They prevent the formation of alliances with other countries. They do not have an effect on the domes

Closely read the following sample dictionary entry for the word “septentrion.” “septentrion (sep ten’trē on’) n. Obs. 1. The north” What indicates to the reader

What kind of resource is corn? A. animal resource B. mineral resource C. plant resource D. fossil fuel

Who was the first ruler of the aztecs when cortes conquer the aztec empire ?