gamermeli55
gamermeli55 gamermeli55
  • 12-11-2020
  • Biology
contestada

Trilobites are used as index fossils because

Trilobites are used as index fossils because class=

Respuesta :

jhgkjhgjnghjyfmn jhgkjhgjnghjyfmn
  • 12-11-2020

Answer:

d

Explanation:

Answer Link

Otras preguntas

what are the three main reasons for European imperialism in Africa?
Action/reaction force pairs act on (Blank).
1 - 4 + 2x + 4= 13 What does 'x' equal? Please give reasonable answer
what is atherosclerosis
a globe is an example of a physical model true or false
Rewrite the following sentence to eliminate flowery language. I was glum, tired, frustrated, and not at all in the mood for my annoying, penetrating, monotonous
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
In the followoing sentence what is the participial phrase: The blue dress, fraying at its seams, snagged on the brambles in the dark woods.
In an effort to bolster its economy while remaining responsible to the environment, what industry is Costa Rica promoting? A. hand craft trade B.
Q: if AB is parallel to CD, which statement is true? Answers: A- AB And CD do not intersect B- AB And CD intersect at 90 angles. C- The perpendicular distance