AlesZachwievonnama
AlesZachwievonnama AlesZachwievonnama
  • 12-10-2016
  • Social Studies
contestada

The united states wants to protect its car companies. so it puts a(n) _____ on japanese cars to make foreign cars more expensive. antitrust law export tariff

Respuesta :

andxprz
andxprz andxprz
  • 12-10-2016
it's probably export tariff
Answer Link

Otras preguntas

If you can buy 1/2 of a gallon of milk for 3 dollars, how many gallons can you buy for 5 dollars? Write your answer as a fraction of a gallon.
Animals can change the energy in food into energy the animals can use. What type of energy is in the food before the animals change it?
A rational expression simplifies to 1/2. The denominator of the original expression is given. Which polynomial is the numerator? ? ______ 6x^2-2x-8 A
Write the standard equation of a circle with center (2, −5) and radius 16.
i need help for this one, How many one-third cup servings are in 6 cups of pecans
which solution contains the correct number of significant digits for the product 2.80 mm : 0.1 mm
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
Name a muscle found in the cat but absent in the human that can extend the forelimb
Convert. If necessary, round to the nearest tenth. (Recall: 1 mi ≈ 1.61 km) km/h ~ 10 mi/h
It is better to be part of a group than it is to be alone? True or false,,,, Why?