Likaresevasweet Likaresevasweet

15-10-2016
Chemistry

contestada

What is 420,000 in scintific noattion?

Respuesta :

jasonjj jasonjj

15-10-2016

The scientific notation of 420,000 is : 4.2 x 10 ^ 5

Answer Link

Otras preguntas

Frieda, age 16, is a boating enthusiast who can tie 20 different kinds of knots. This type of knowledge is most aptly described as __________ knowledge.

One side of the moon always faces Earth because the time it takes the moon to spin on its axis is blank the time it takes the moon to travel around Earth.

If a chemical that interrupts cell division is added to a culture liver tissue,which process would stop?

Whenever Richard Cory went down town, We people on the pavement looked at him: He was a gentleman from sole to crown, Clean favored, and imperially slim. And he

Which of the following equations represents a vertical compression of the linear parent function and a flip over the x-axis? A. y=3x B. y=1/3x C. y=-1/

Those addicted to drugs and alcohol suffer from compulsive drug and alcohol cravings and usage and cannot quit by themselves.

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

(SELECT ALL THAT APPLY) WILL REPORTSelect the items that were part of the Missouri Compromise. A.Texas was admitted as a slave state. B Missouri was admitted

Which is greater 2/3 or 7/8

Public opinion is most value when the people who hold an opinion