isidorogarcia832 isidorogarcia832
  • 14-12-2020
  • Biology
contestada

Grass starts with 30,000 kcal of energy. A cheetah would acquire ( ? ) kcal of energy after it ate a zebra that had consumed the grass.

Respuesta :

WilliamKDQ
WilliamKDQ WilliamKDQ
  • 08-03-2021

Answer:

300

Explanation:

on edge2021

Answer Link

Otras preguntas

on a game show that are 10 keys in the bag and three of the key start a car and contest in randomly choosing the key it doesn't not start the car she returned t
hey can you please help me posted picture of question
How much energy must be absorbed by 20.0 grams of water to increase its temperature from 283 c to 303 c in joules. How do you work this out
What divided the eastern and Western Europe after ww2
The average person drinks one pint of milk a day at this rate how many gallons will a person drink in 366 days
Name three of the numerous tricks puck enjoys playing on humans.
Which of the following Supreme Court cases directly relates to the phrase "separate but equal"? Plessy v. Ferguson and Brown v. Board of Education Tinker v.
Select all of the ongoing costs associated with renting. (MORE THAN ONE!) Please and thank you :) rent payment security deposit utility bills homeowner's insura
Research on gender differences in cognitive abilities indicates that there exists
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se