1479ab01 1479ab01

13-01-2021
Mathematics

contestada

Which one?? help please for a grade!! due today

Which one help please for a grade due today class=

Respuesta :

perryfallon12 perryfallon12

13-01-2021

Answer:

its 10

Step-by-step explanation:

because all you have to do is add a zero for each place you go

Answer Link

blackravenriver blackravenriver

13-01-2021

Answer:

First one 10

Step-by-step explanation:

Answer Link

Otras preguntas

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Recent research into what causes working memory deficits in older adults has found that

Would someone Please answer this question please will be thanked and also will pick brainly!! (please be honest)

The Navigation Acts were meant to destroy Spanish trade. True or False

) which is not a major function of the kidney? which is the normal ph range of urine in humans?

There are 100 students at the end of year school bar-b-que. The ratio of boys to girls is 4:6. The ratio of vegetarian girls to omnivorous girls is 1:1. How man

The Emergency Medical Treatment and Active Labor Act is a federal law that makes sure that patients receive emergency medical care regardless of their ability t

the action or state of setting someone or something apart from other people or things or being set apart. "the segregation of pupils with learning difficulties"

if you want your crops to grow larger than they normally would,you may want to try adding

How did they treat depression during the Great Depression?