Seudónimo Seudónimo
  • 14-01-2021
  • Mathematics
contestada

3) plllllllllllsss help

3 plllllllllllsss help class=

Respuesta :

sylviasushi
sylviasushi sylviasushi
  • 14-01-2021

Answer:

C

Step-by-step explanation:

Because they both are the same

Answer Link

Otras preguntas

Dingo Division’s operating results include: controllable margin of $150,000, sales totaling $1,200,000, and average operating assets of $500,000. Dingo is consi
A good scientific hypothesis is tied to observable phenomena. capable of being proven. logically impossible to refute. based on a relatively new theory.
the augmented limb leads are​
Kuhn does not have any retained earnings available to finance this project, so the firm will have to issue new common stock to help fund it. Its common stock is
Cesar claims he found a definite way to save money, "Buy direct from the manufacturer. Any time intermediaries get involved, you'll pay a higher price. After al
Describe what is meant by self-incompatibility. Briefly, describe the mechanism for it.
Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'
Match the stimuli to the sensory auditory receptors that respond to them
Rihanna Company is considering purchasing new equipment for $468,600. It is expected that the equipment will produce net annual cash flows of $66,000 over its 1
How does sound travel through different mediums?