animesvertyfaa animesvertyfaa

15-02-2021
Mathematics

contestada

Lütfen acil cevaplar mısınız çözümüyle 8.sınıf sorusu

Lütfen acil cevaplar mısınız çözümüyle 8sınıf sorusu class=

Respuesta :

panicanangelica513 panicanangelica513

16-02-2021

Answer:

I don't know what you saying but it's kinda cool

Answer Link

Otras preguntas

People who are heterozygous for a loss of function mutation in their retinoblastoma gene and a wild type allele

Need help please, pt 4 Thanks!

For one History test, John had to answer 45 questions, John answered 33 of them correctly. What percent did John get on his history test? Round your answer to t

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Which statement is supported by information presented in the graph? PLZ HELP ASAP In 2010, the United States exported more to Mexico than it imported. As a r

Which sentence uses the past progressive tense of read? A. We are reading our novels on the airplane. B. We read our novels on the airplane. C. We were

Can you please answer 7-19 thanks!!

A class has a total number of 39 students. The number of males is 7 more than number of females. How many males and how many females?

Find the real-number root. −2.56−−−−−√

the function below represents the monthly charges for a cell phone where x is the number of minutes used.y = 0.05x + 25What would be the amount of the bill if t