Sarah8704 Sarah8704
  • 13-11-2016
  • Chemistry
contestada

Lewis Structure of CH3Ch2NH3+

Respuesta :

nmstar
nmstar nmstar
  • 13-11-2016
H H H
| | |
H–C—C— N –H
| | |
H H H
Answer Link

Otras preguntas

Solve the recurrence relation for the variables indicated below: bn = 8bn-1 - 15bn-2 b1 = 2 b2 = 16 If the explicit formula for the sequence is wr
The value of the digit in the hundreds place in the number 653841 is 1/10 the value of the digit in the thousands place in which numbers
What are the four components necessary for a plant to perform photosynthesis? a.chloroplasts, sunlight, carbon dioxide, and water b. ribosomes, seasons, carbon
express 7.25 in scientific notation
Why would a lack of neurotransmitters cause a problem in the nervous system??
I don’t really get it please help me out!
what action did the north take to cause serious problems for the south??? PLZ ANSWER NOW HAVE TO TURN IN BY TOMORROW!!!
plzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz help plz :(In order for a fish to see a bug just above the surface of the water, the image of the bug travels i
ulia demonstrated the formation of a type of rock. She mixed egg, salt, and herbs and cooked the mixture over a flame. The egg turned into an omelet. The format
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’