sanjusanjna11 sanjusanjna11
  • 11-03-2021
  • Chemistry
contestada

How does a metal chair in the sunlight outside get so out that it can burn you?

Respuesta :

haasetajm haasetajm
  • 11-03-2021

Answer:

It absorbs the sunlight and gets heated instantly because of the mocelcules in a metal object.

Explanation:

Answer Link

Otras preguntas

according to jean piaget which term refers to a child applying an existing schema to a new object?
Which number is the closest approximation to the value of [tex]\sqrt{83}[/tex]? A) 9.1 B) 9.2 C) 41.5 D) 41.6
The tune of the song is referred to as the melody. True False
helps pleasee 20 points​
Which one of these go with causes​
Replication, Transcription, and Translation Chart Please answer DNA Replication: 1。Template Strand: Start with this nucleotide chain. TACCCTTGAATAAAAAATCTCTGTTT
a scribe is someone who a. Took notes in Roman court b. Made copies of scrolls Hebrew scripture
Help plz:))) I’ll mark u Brainliest
por favor escriba una historia con las siguientes palabras es broma puntos libres
Which model represents a unicellular organism?