AliiMariiiee151 AliiMariiiee151

12-03-2021
Mathematics

contestada

The point P = (x, 1/3) lies on the unit circle shown below. What is the value of x in simplest form?

Respuesta :

theonlyrobertwilson theonlyrobertwilson

23-03-2021

Answer: - 2squart2/3

Step-by-step explanation:

x^ 2 + y ^ 2 = 1

x ^ 2 + (1/3) ^ 2 = 1 ^ 2

Answer Link

Otras preguntas

about pythagorean theorem, really need help!

The excerpt supports the conclusion that Gertrude ignores what Hamlet says because she thinks he’s crazy. can’t bear listening to Hamlet because she knows he’s

Cecil and three friend ran 15-mile relay race. Each friend ran an equal distance. What distance did each friend run?

Please see attachment somewhere around this question I could really use the help

What organisms went extinct in the Carboniferous period

HELP ASAP photo attached

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

You are driving to visit a friend in another state who lives 700 miles away. You are driving 65miles per hour and have already driven 375 miles. Write and solve

convert 750ml to litres

Item 6 Question 1 The box-and-whisker plot represents the numbers of gallons of water needed to fill different types of dunk tanks offered by a company. a. What