kalebsquiabro kalebsquiabro

12-03-2021
French

contestada

En Avril 2019, il y a un groupe de ________ pays dans l'Union Européenne.

Respuesta :

13-03-2021

En Avril 2019, il y a un groupe de 28 pays dans l’Union Européenne.

PS : en 2020, le Royaume-Uni a quitté l’Union Européenne maintenant elle compte 27 pays.

Answer Link

BrainlyPotter BrainlyPotter

14-03-2021

Answer:

En Avril 2019, il y a un groupe de 28 pays dans l’Union Européenne.

Answer Link

Otras preguntas

What single cell do specialized cells develop from?

Which conditions promote karst development? dry climate good groundwater circulation hard rocks near Earth’s surface moderate to heavy rainfall poor groundwater

Why did Lech Walesa win a Nobel Peace Prize in 1983?

For each of the described curves, decide if the curve would be more easily given by a polar equation or a Cartesian equation. Then write an equation for the cur

It takes Jen 2 1/2 hours to ride 32 1/2 miles on her bicycle. What is Jen’s average number of miles per hour?

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d

how did Whitney in the most dangerous game change over time

An electron is trapped in an infinite square-well potential of width 0.2 nm. If the electron is initially in the n = 4 state, what are the various photon energi

What is the (y) to this equation -5x+2y=13 5x+y=-1

what is b-1 over b-1