jamaal537 jamaal537

13-03-2021
Arts

contestada

I need Help ASAP will mark brainliest
A. Notate the indicated triad using the given pitch as root.
B. Notate the indicated triad using the given pitch as third.
C. Notate the indicated triad using the given pitch as fifth.

I need Help ASAP will mark brainliest A Notate the indicated triad using the given pitch as root B Notate the indicated triad using the given pitch as third C N class=

Respuesta :

skjsfbndbsndndnd skjsfbndbsndndnd

13-03-2021

Eenie minie moe told me to pick B

Answer Link

Otras preguntas

The ______ is located at the bottom of the uterus and must dilate 8cm during childbirth

How does the cartoon illustrate one of the league’s major problems?

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

The joining together of two ducts or blood vessels to allow flow from one to the other is an/a:

What ways did cleisthenes made the athenian government more democratic?

What is the density of an 800 gram object that occupies 200 cm 3 ?

Factorise : 16x^2 +72xy + 81y^2 -12x +27y

Help on both and I will give you 98 points

I need help with this

which of the following is an example of helping verb?