sdfhuljhtvhdfl sdfhuljhtvhdfl

15-11-2016
Mathematics

contestada

A customer pumps $35.40 total in gas and pays with a $50 bill. What is the amount of change the customer should receive?

Respuesta :

bertraxxxx bertraxxxx

15-11-2016

$50 - $35.40 = $14.60

Answer Link

Аноним Аноним

15-11-2016

The customer should receive 14.50 back in change

Hope this helps!

Answer Link

Otras preguntas

How did the Balfour Declaration conflict with a promise Britain made to Arabs living in Palestine?

The point (–4, –2) is reflected across the x-axis.

Woud earth be the same after losing its gravity,,.¿and how it gets affected by others planets,,.¿

what are the possible question of public sector under essay?

the meaning of socio economic issues

Can someone please do this (look at image) please I’ll mark you as brainliest and you’ll get 45 points please. (Sorry if the photo isn’t clear)

What did some progressives believe could lead to a better human race through selective breeding? A prohibition B temperance С eugenics Dconservation E none of t

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

A list is made of all possible 2-digit whole numbers that result from using only the digits 1,3,5, and 7 in both theones and tens place, with duplications allow

Which of the following is a major goal of fisheries managers? A.Using resources intelligently so they will be preserved. B.Increasing fish production as much as