jaykoning11
jaykoning11 jaykoning11
  • 11-04-2021
  • Mathematics
contestada

Find the conjugate and product of

2-i5 ​

Respuesta :

nuuk nuuk
  • 16-04-2021

Answer: [tex]2+i5,\ 29[/tex]

Step-by-step explanation:

Given

Complex number is [tex]2-i5[/tex]

Its conjugate is obtained by changing the sign of the original number i.e. [tex]2+i5[/tex]

The product of the two numbers is

[tex]\Rightarrow (2-i5)(2+i5)=2^2-(5i)^2\quad \quad [(x+y)(x-y)=x^2-y^2]\\\\\Rightarrow (2-i5)(2+i5)=4-25i^2\\\\\Rightarrow (2-i5)(2+i5)=4+25=29[/tex]

Answer Link

Otras preguntas

be Which plot element is repeated in "A Wolf and Little Daughter"? A. Little Daughter fills a vase with the flowers she picked. B. O Little Daughter sees a flow
Identify the structures of the male reproductive system using the drop-down menus.
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
As SCUBA divers go deeper underwater, the pressure from the weight of all the water above them increases tremendously which compresses the gases in their blood.
answer with work pls!!
Jane has chosen to attend the university of north Texas (UNT) for four years and earn a four year undergraduate degree in software engineering. Tuition and fees
What is the slope of y = -4?
The key elements of creating effective advertising revolve around the two categories of ____ and design. A. Promises B. Content C. Music D. Graphics
Whats you favorite color of the alphabet true or false
Why were early rap records economical?