kukorelly35 kukorelly35

13-04-2021
Biology

contestada

hey can someone answer pls?
will mark branliest and follow thanks!

hey can someone answer pls will mark branliest and follow thanks class=

Respuesta :

aprilsurac76 aprilsurac76

13-04-2021

A is correct

////

key word different

AAAAAAAAAAAAAAAAAAAA

Answer Link

Otras preguntas

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Which field is not used for non inventory products

Help!!! With this math question

The reaction between salicylic acid and acetic anhydride is considered: A. A polymerization reaction B. An oxidation/ reduction reaction C. An esterification

As shown in Exhibit 5-4, using the income approach, gross domestic product (GDP) is:

Aluminium appears unreactive. This is because it has a layer of what covering its surface? Enter your answer

Please help me I beg you I love you!

Return We tried to stop Rosa from jumping, but her type your answer.... disregard o disregard of our warnings led to a type your answer..... would change her li

like someone tell me.............................................................................................. why am i so boredddd? bc like were yall went

Please help! Find y" for siny + cosx = 1I already got the first derivative (y'), but I don't know how to get the second.