RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Respuesta :

officialscripture officialscripture

14-04-2021

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Answer Link

Otras preguntas

Row reduction of the augmented matrix 2x-y=7 3x+4y=-6

Solve the following equation for r2: Q = 2sL(T2-T1)/ln(r2/r1) when: Q=1,500,000, s=30, T2=275, T1=22, L=10, r1=6.

what did Mao's long march accomplish? Why was it successful?

what is the solution to the square root of 5x +4 = x-4

Which of the following describes a reason that colonial New England tended to have only small family farms? New England is largely mountainous terrain. New Engl

what is surrounded by Quebec, Ontario, Manitoba, and Nunavut

Express 5/21 as a decimal.

Which innovation extended the number of hours in a day that Americans could work and play

Many indigenous people in Guatemala live in the mountains because what?

solve by factoring 7b^2-8b+3=2