jazminruiz900 jazminruiz900
  • 15-04-2021
  • Mathematics
contestada

What is an equation of the line that passes through the
point (8, –8) and is perpendicular to the line
4x-3y=18?

Respuesta :

samuel726
samuel726 samuel726
  • 15-04-2021

Answer:

3x+4y+8=0

Step-by-step explanation:

m, slope=4/3 but the line is perpendicular then m=-3/4

y-y1=m(x-x1)

y-(-8)=-3/4(x-8)

multiply both sides by 4

4y+32=-3(x-8)

4y=-3x+24-32

4y=-3x-8

3x+4y+8=0

Answer Link

Otras preguntas

Gail works for Ice Cream To-Go. She needs to fill the new chocolate dip cones completely with vanilla ice cream, so that it is level with the top of the cone. G
In October 2012, one US dollar could buy about _______ Canadian dollars. A. 0.88 B. 0.98 C. 1.08 The exchange rate remained unchanged from ________ A. Oct. 2012
what is greater 8 hours 520 minutes
the adjacent angles of a parallelogram are in the ratio 2:1 find all the angles
One brand of plastic garbage bags costs $8.99 for 45 bags. A second brand costs $7.75 for 32 bags. If you have a savings coupon for $0.25 for the second brand,
A set of data has 12 pieces of data. Which of the following statements is NOT TRUE? A.) There are 3 pieces of data in the first quartile. B.) There are 6 pieces
Factor completely: 4x^3+12x^2+x+3
This circle graph shows the parts of her time that Kim spends listening to different types of music. Kim spends her time listening to which type of music?
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
One edge of a cube measures 5.4 meters. What is the volume of the cube?