carcool77 carcool77
  • 14-06-2021
  • Mathematics
contestada

Find the size of the angle below

Find the size of the angle below class=

Respuesta :

anthonya4385 anthonya4385
  • 16-06-2021

Answer:

i wish i could tell you

Step-by-step explanation:

Answer Link

Otras preguntas

A(n) ____ will, for a commission or fee, arrange the sale of a company's products to foreign intermediaries.
Find the solution of the differential equation that satisfies the given initial condition. y' tan x = 5a + y, y(π/3) = 5a, 0 < x < π/2, where a is a const
Explain why the following statements are true: 1) All matter is made up of atoms. 2) An electron with a proton equals a neutral charge. 3) All atoms are in c
need help one of three final exams! Between 2000 and 2010, which state had a population growth of 15–25 percent? Alabama Georgia North Dakota Ohio
The governmental body responaible for interpreting the constitution is the
6200ft is <>= to 1mi 900ft
Zinc reacts with aqueous sulfuric acid to form hydrogen gas: zn(s) + h2so4(aq) → znso4(aq) + h2(g) in an experiment, 201 ml of wet h2 is collected over water at
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
Question 3 Unsaved Which type of galaxy is the Milky Way ? Question 3 options: elliptical satellite irregular spiral
Corporate bonds from Hyren Airlines are selling at 106.133, bonds from Xyx Motors are selling at 97.701, and bonds from Ergar Appliances are selling at 101.294.