dtucker787 dtucker787

16-06-2021
Mathematics

contestada

PROBLEM 1
What is the distance between (2,2) (4,7)

Respuesta :

MathematicalOnion MathematicalOnion

16-06-2021

Answer:

2,5

Step-by-step explanation:

2 - 4 = 2

2 - 7 = 5

So the answer is 2,5

I think.

Answer Link

Otras preguntas

What was the outcome of the Yalta conference?

The speed of light in four different materials is shown below: Which material is the least dense? Material A Material B Material C Material D

Which form of birth control could people use without altering hormonal systems or blocking sperm from fertilizing an egg? Fertility Awareness Birth control pil

Being fair doesn't have to mean applying the same rules for everyone. true or false.

What kind of animal is balaenoptora borealis

the social effects of United States mobilization of world war 2

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

A circle with circumfrence 10, has an arc with 160 degree angle

Abduction requires the action of two muscles, and adduction requires the action of __________.

I have a Brainliest please help