jadeandryna0609 jadeandryna0609

13-07-2021
Mathematics

contestada

write the equation for a parabola with a focus at (-3,-5) and a directix at x=-7

Respuesta :

Аноним Аноним

13-07-2021

Answer:

y = -28x²

Step-by-step explanation:

[tex]{ \bf{ {y} = 4a {x}^{2} }} \\ { \tt{y = - 28 {x}^{2} }}[/tex]

Answer Link

Otras preguntas

Calculate the molecular (formula) mass of each compound: (a) iron(ll) acetate tetrahydrate; (b) sulfur tetrachloride; (c) potassium permanganate.

why are laws required?

As the interest rate falls, a. the quantity of money demanded falls, which would reduce a shortage. b. the quantity of money demanded falls, which would reduce

How did Columbus plan to acquire goods from Asia less expensively?

Which of the following is INCORRECT when considering the lac repressor? a. Binding to the operator site is cooperative. b. It is tetramer of two dimers. c. It i

regina charges c dollars per hour to babysit. if she increases her rate by 15%, which expression represents her new rate, in dollars per hour?

A stranded soldier shoots a signal flare into the air to attract the attention of a nearby plane. The flare has an initial vertical velocity of 1500 feet per se

Select the correct statement regarding the contribution margin ratio. Multiple Choice The contribution margin ratio equals contribution margin per unit divided

______________ is the ability to control your emotions and act with honesty and integrity in reliable and adaptable ways.

Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'