jbwhalen1446 jbwhalen1446
  • 13-09-2021
  • Computers and Technology
contestada

jnhj hjibfnufnbfjbnkfv fj v

Respuesta :

cookwan27
cookwan27 cookwan27
  • 13-09-2021

Answer: baller.

Explanation:

Answer Link

Otras preguntas

to serve humanity is to serve God ​
please help with at least one​
Factorise the following: 1)x^2+10x+16 2)x^2+7x+12 3)x^2+13x+12
A commercial real estate loan may take 90 days from the signing of the purchase and sale contract until loan closing. Therefore, there is the possibility for in
In living organisms the cell cycle is closely regulated. What do you think will happen if cell division is not controlled?
An organization's _____ is defined as a more specific goal than the organization's purpose that unifies company-wide efforts, stretches and challenges the organ
Write a function max that has two string parameters and returns the larger of the two, that is, a string should be returned. (By larger we mean alphabetically,
A healthy environment depends on biogeochemical cycles maintaining a balance of input and output. High levels of nitrogenous compounds in the waterways can caus
Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5
What is denser, salt water or cold water? Why?