13-09-2021
Mathematics

contestada

What’s a value of 2:10?

Respuesta :

Аноним Аноним

13-09-2021

Step-by-step explanation:

a value of 2:10= 1:5

Hope it helps

Answer Link

Otras preguntas

Write 2 quadratic equations (of any form) that are not equivalent, each with a vertex of (4,5).

Consider the following generic reaction: A+2B→C+3D, with ΔH = 157 kJ . Determine the value of ΔH for C+3D→A+2B.

An oil slick is expanding as a circle. The radius of the circle is currently 2 inches and is increasing at a rate of 5 inches per hour. Express the area of the

PLEASE HELPP URGENTTT Using the below documents and your understanding of the U.S. Criminal Justice System, analyze the extent to which our criminal justice sy

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

what is 5/3x +1/3 = 13/1/3 + 8/3x

Which of the following is least likely to impact the natural increase rate of a country? Standard of living Gender inequality Immigration Cultural norms Governm

Susan has a credit card with an APR of 10.3%. For the billing period ending on June 5, average daily balance (ADB) on her credit card was $110.43. What is month

poor economic condition for health and prosperity of the people justify the statement

These two trangles are scaled copies of one another. the area of the smaller triangle is 9 square units.