22izaiahlongbrake 22izaiahlongbrake

12-10-2021
Engineering

contestada

A vehicle is towed into a shop with a thrown serpentine belt.

Respuesta :

alexminster1 alexminster1

12-10-2021

Answer:

A checks for a worn pulley bearing. Technician B checks for a faulty tensioner. Who is correct they are both correct

Explanation:

Answer Link

Otras preguntas

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

In a random sample of 75 individuals, 52 people said they prefer coffee to tea. 99.7% of the population mean is between what two values?

On a skiing trip there are five people but only three pairs of skis how many different groups of three could ski

What was the overall goal of richard nixon's southern strategy? answers?

sq is an angle bisector m <qst=2x and m <qsr=3x-10 what is <rst

The primary sugar in milk and dairy products is... A) lactose B)sucrose C)maltose D)fructose

Which list places the magma types in order of decreasing viscosity? A. basaltic, rhyolitic, andesitic B. andesitic, basaltic, rhyolitic C. basaltic, andesitic,

Use logarithms to solve each equation 2x 9/8=111 A. 18.9561 B.25.8961 C. 10.2587 D. 35.5208

A word problem using system of linear equations of form Ax+By=c Problem: a fruit company delivers fruit in 2 types of boxes. Large and small. A delivery of 3 l

A computer is used to generate passwords. Passwords are made up of numbers from 1–6 and lowercase letters. The computer generates passwords one character at a