Soul1231 Soul1231
  • 11-11-2021
  • History
contestada

Did the Roman Republic like change?

No
Yes
Maybe

Respuesta :

hello1614
hello1614 hello1614
  • 11-11-2021
No they actually didn’t like change
Answer Link

Otras preguntas

please help asap i dont understand what is the slope of a line perpendicular to line A
BRAINLIESTTTT ASAP! PLEASE ANSWER The function H(t) = −16t^2 + 75t + 25 shows the height H(t), in feet, of a baseball after t seconds. A second baseball moves i
A laptop computer communicates with a router wirelessly, by means of radio signals. the router is connected by cable directly to the internet. the laptop is 8.7
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
if the measure of ab is 8, find the length of circle c
Can someone help !!!??
Use diffusion to explain what happens when you drop sugar cube into a mug of hot tea
Seven friends picked 7 quarts of blueberries. Three of the friends will share 4 quarts blueberries equally and the other 4 friends will share 3 quarts of the bl
Factor the expression. 4x(x^2 − 7) + 3(x^2 − 7)
which statement best completes the diagram related to the supreme courts procedures? A.justices debate the importance of different cases. B.congress determines