123me123
123me123 123me123
  • 14-11-2021
  • Mathematics
contestada

100 points. Math Question

100 points Math Question class=

Respuesta :

smuntaha61111 smuntaha61111
  • 14-11-2021
The answer is -2. Hope this helps
Answer Link
aaravcsd aaravcsd
  • 24-11-2021

Answer:

The answer is 2.

Step-by-step explanation:

Answer Link

Otras preguntas

someone please help me
16. By approximately what percentage has the concentration of carbon dioxide increased in the atmosphere since 1950? 20% 37% 17% 40%
Given: AB = CD Prove: AC = BD
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
do you like chihuahuas
PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
What did this command do? mv ../* .cpp . (In linux ubuntu)
please help me with this question!!(first CORRECT answer gets brainliest)
A B Which type of bacteria stain purple during Gram staining? Gram-negative bacteria Gram-positive bacteria this
write an article for you school magazine about how most of the people in recent times do not come forward to help a person in need. Write about any incident exp