suF6oautifmchellton suF6oautifmchellton

15-01-2017
Biology

contestada

The symbol na represents a sodium atom that has lost an electron. true false

Respuesta :

Аноним Аноним

15-01-2017

False.
It represents neutral atom. "Na+" is the ion which has lost an electron

Hope this helps!

Answer Link

Otras preguntas

What do the letters N S E W mean when they accompany labels for latitude and longitude?

Identify whether the following equation has a unique solution, no solution, or infinitely many solutions. 2( − 4) = 10 − 8 − 8 A unique solution B no solution

Courses that enable students to begin jobs that require course completion certificates are known as:

Find the surface area of the prism.

Can I get help and no links pls

What is the mood i need help

Find a perimeter of a pool

What is the relationship between the volume of a rectangular prism and a rectangular pyramid having both congruent bases and heights?

How did the Columbian exchange lead to the development of capitalism

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT