coxjennifer1984 coxjennifer1984
  • 12-01-2022
  • Mathematics
contestada

Amanda cut a wire into 4 equal pieces the wire was not originally 7.92meters long how long is each piece?

Respuesta :

vnava7958 vnava7958
  • 12-01-2022
Each piece of wire is 1.92 meters
Answer Link

Otras preguntas

Which statement is true about two angles that are complementary? The angles share a common ray. The sum of the measures of the two angles is 90°. The angles are
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
three album downloads cost $36. how much do 5 downloads cost
How does Dickinson support her assertion that poetry is more expansive than prose? 1. She looks for examples of the wondrous in the world. 2. She argues that
Which of the following statements about orienteering is not true? A. It's limited in popularity to the U.S. and Europe B. Each individual starting location is
If you get a flu shot one year why would you need to get it the next year ? why you aren't still protected from the flu ?
which of the following is involved in asexual reproduction? A) sperm cells B) egg cells C) a zygote D) none of the above
Which of these is a body tissue
In Hard Times by Charles Dickens, why does the government official object to depicting horses on wallpaper and flowers on rugs? He has doubts about the value of
How are organisms in the domains bacteria and archaea similar answers?