w4yjq7mqkr w4yjq7mqkr

13-01-2022
Mathematics

contestada

What expression is equivalent x^-8

Respuesta :

Аноним Аноним

13-01-2022

Answer:

[tex]x^-^8 = y^-^8[/tex]

Step-by-step explanation:

Any variable is equivalent to x^-8.

hope this helps.

Answer Link

Otras preguntas

Why did the East India Company want to establish forts in the Indian Ocean?

What is the solution to the following system? [3x+10y-12z = 40 X-5y = 0 X-4z = 0 (8, 40, 32) (10, 2, 3) (20, 4, 5) (40, 8, 10)

What is an advantage of showing video clips of elephants trying to pull a table with treats towards them in the video, “Elephants Show Cooperation on Test”? a.

Freaky friday questions p2

Question 2 (1 point) A zinc production company uses the following chemical reaction: Ca Calcium 15 g + Aqueous Solution ZnCO₂ Zinc carbonato 25 g Aqueous Soluti

QUICK!! EMERGENCY!! PLEASE HELP ME!! As shown in the graph, Jane has a car payment of $200 a month. Her loan amount is $3,000. Assume there is no interest. A. W

h) In a certain county there are two radio stations: the Maisha FM and the Jambo FM. A researcher interested in the loyalty to stations of this county found the

Women gained suffrage, or the right to vote

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Which sentence contains an underlined restrictive clause? O The books that are stacked neatly on the top shelf belong to my great-grandfather. O The girl who br