itired04 itired04
  • 15-02-2022
  • Physics
contestada

Is .788 greater then 0.394

Respuesta :

sophielauren23 sophielauren23
  • 15-02-2022
yes since 7 is greater than 3
Answer Link
zulabidin2007
zulabidin2007 zulabidin2007
  • 15-02-2022

Explanation:

.788 × 100=78.8%

0.394 × 100=39.4%

.788 is greater

Answer Link

Otras preguntas

If f(x)=5x2−3x+8, find f(0)
A characteristic of a Traditional Economy is... A:Government control of all resources B:Profit is the main motivator C:Private control of businesses D:Farming
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG
List the powers and immunities of the Texas Legislative Branch
Given that f(x) = x2 + 4x, evaluate f(-2).
Most of the people who traveled along the Oregon Trail tended to be all of the following EXCEPT: A) young B) merchants and traders C) with their families D)fair
|5z−8|=7 Can someone help me with this question I will mark you brainliest if you get the correct answer. THANKS!! :))
7. Is a triangle with side lengths 9, 18, 7 a right triangle, an acute triangle, or an obtuse triangle?​
PLEASE HELP ASAP! Will give BRAINLIEST! Please answer correctly! No guessing!
Can anyone help with this ???