farhan3khiro farhan3khiro

11-06-2022
Chemistry

contestada

How many grams of lead(II) nitrate, pb(NO3)2,are present in 4.05 moles

Respuesta :

skytimex2012 skytimex2012

11-06-2022

1340 is the answer I think

Answer Link

jsimpson11000 jsimpson11000

11-06-2022

Answer:

1341.1737 gm in 4.05 moles

Explanation:

From periodic table

mole weight pb = 207.2 gm

N 14.007 *2 = 28.014 g,

O 15.99 *6 = 95.94 gm

total= 331.154 gm per mole * 4.05 moles =

Answer Link

Otras preguntas

How does T.J.’s relationship with Cassie relate to the theme of friendship in this chapter of Roll of Thunder, Hear My Cry?

How does unemployment lead to crime

Evaluate the function [tex]h(x) = x^4 - 3 x^2 + 3[/tex] at the given values of the independent variable and simplify. a. h(-3) b. h(-1) c. h(-x) d. h(3a)

Which is equivalent to 1/2? Select ALL that apply. A. sin 30° B. sin 45° C. cos 45° D. cos 60° E. tan 30° F. tan 45°

4. Find the area of the polygon Select the appropriate response: A) 1200 sq inches B) 21 square inches C) 360 sq inches D) 180 sq inches

Read each sentence and determine whether it is compound, complex, or compound-complex. “Federico is a talented painter, but Maria is the best all-around artist

Demand each period is normally distributed and an order-up-to model is used to decide order quantities. Which of the following influences the chosen order-up-to

Solve the equation. Check your solution. 3 = m/12

Two boards, one four inches wide and the other six inches wide, are nailed together to form an X. The angle at which they cross is 60 degrees. If this structure

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1