Lyreen5311 Lyreen5311

15-06-2022
History

contestada

What was the occupation of paul revere, who made the famous ride from boston to lexington to warn of a british attack in 1775?.

Respuesta :

miamarie2609 miamarie2609

15-06-2022

Boston silversmith.

Answer Link

Otras preguntas

What are three major classes of RNA found in the cell?

What are the roles of Hydrogen peroxide, oxygen, hydrogen and catalase

What layer of a bone lines the medullary cavity?

The ______ displays current information about the spreadsheet

In addition to subaverage intellectual functioning, a diagnosis of _____ requires that a child show deficits relative to his or her age group in at least two of

How is nucleotide biosynthesis regulated? How is the enzyme ATCase regulated?

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

What are the roots of x in -10x2 + 12x - 9 = 0?

Which settlement was part of New Spain? A. Massachusetts Bay B. St. Augustine C. Brazil D. Cíbola

(0.5n^5)^2(10n^7)^3 Find the product.