dakotajones0307 dakotajones0307

13-07-2022
Mathematics

contestada

A single die is rolled twice. Find the probability of rolling a 1 the first time and a 4 the second time.

Respuesta :

wafflefly21 wafflefly21

13-07-2022

Answer:

1/36

Step-by-step explanation:

There is an 1/6 chance of rolling 1 the first time and 1/6 chance of rolling a 4 the second time. 1/6 * 1/6 = 1/36 chance of rolling a 1 then 4.

Answer Link

Otras preguntas

U have 8 feet 2 feet 2 feet 1 foot what is the area in square feet

What is the value of x in the solution to this system of linear equations? 4x - 3y = 3

Who would be best suited to analyze budgets, create reports, explain information to others, and handle internal company procedures and finances? A Receptionis

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Find the values of x for which the series converges. (enter your answer using interval notation.) ∞ (x + 9)n n = 1 find the sum of the series for those values o

6(−2g−1)=−(13g+2) Solve for g

Which state abbreviation should be used in the following address?Ms. Hannah Lin 555 W. 18th St. Santa Ana, _____ 99838CALICACalif.Californ.

Ywxz is a rhombus with diagonals that intersect at point s. angle wsx measures 3 x plus 12 degrees find the value of x.

Provide two examples of environmental deprivation. Describe how they can influence intelligence.

Having trouble with this one can someone teach me how to find the slope in this question. Try to help me learn it aswell. Its in the file down below (Find the S