thatonechild thatonechild

15-07-2022
Biology

contestada

What is the replicated DNA sequence for GGC GAG AAT GAA ACT ATT TGT AGC

Respuesta :

ariahuds8154 ariahuds8154

15-07-2022

Answer:

ccgctcttactttgataaacatcg

Answer Link

Otras preguntas

what property is 65t=t(65)

If u = 8 + 4i and v = 3i + 6, then what is u – v? a. 2+2i b. 5-2i c. 1+i d. 2+i e. 2-i

Round each number to the nearest whole number. What is the best estimate for the sum of 225.45 + 90.32? a. 310 b. 315 c. 316 d. 320

Which kind of sentence is this? Hold hands as you walk A. declarative B. interrogative C. exclamatory D. imperative

Indira Gandhi was assassinated because

Let me know who was one of last white president in US

Which word in the sentence is the direct object? We met her at the county fair last night. a. county b. night c. her d. fair

Expanded form for 9,084

what is the decimal equivalent of the fraction 28 over 25

Let a and b be positive integers 23a x 23b = ?