Lyndsay77111 Lyndsay77111

11-08-2022
Physics

contestada

a 70kg car moving at 25m/s take a turn a round the circle with a radius at 30.0m

Respuesta :

noureldinwael2006 noureldinwael2006

11-08-2022

Answer:

[tex] \frac{5}{6} [/tex]

Explanation:

If you want the centripetal acceleration
[tex]a = \frac{v}{r} [/tex]
V = tangental velosity
R = radius
A = centripetal acceleration

Answer Link

Otras preguntas

Read the excerpt from "Sinners in the Hands of an Angry God." So that thus it is, that natural men are held in the hand of God, over the pit of hell; they have

75 POINTS!!!!! Please help me! I need the correct answer! This is my second time posting this cause no one answered. Why is the nucleus shaped like a sphere an

Read the passage. Summer Vacation Everyone kept telling me that a summer trip to Hawaii would be the highlight of my summer. It was the worst week of my life.

Which region seem to provide the greatest obstacle to railroad expansion

The DIAMETER of a sphere is doubled. What is the new volume of the sphere? A) 8/3πr3 B) 16/3πr3 C) 32/3πr3 D) 64/3πr3

I NEED HELP ASP 20 points

1. What is the value of w? 7 3.5 7(sqrt)of 3 14

Which factor is not important when you evaluate the reliability of your sources?

the sum of two numbers is 30 and their difference is 12. Find the two numbers.

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’