sandersmaddison9742 sandersmaddison9742

11-08-2022
Business

contestada

Operational data are commonly stored in many tables, and the stored data represents information about a given _____ only.

Respuesta :

abbebaldi abbebaldi

11-08-2022

Operational data are commonly stored in many tables, and the stored data represents information about a given transaction only.

Answer Link

Otras preguntas

Using the distributive property, an expression equivalent to 48 + 30 is 5 (6 + 8). (6) (8) + (3) (10). (3) (16) + (6) (5). 6 (8 + 5).

David had 20 pencils 5 of them were green and 15 are purple what percentage were green what percentage were purple

find x help please, asap.

Which of these is a feature of audible pedestrian crosswalk signals? A. Emergency instructions B. Responses to voice commands C. Button location signaling D. Pe

What social, political, and cultural norms were challenged by women in the twentieth century?

In circle A measure of arc BD-56' and BC is a diameter. Which statements are correct?

Vinegar is added to baking soda and bubbles of carbon dioxide rapidly form. A cloudy liquid is left behind. What are products in this chemical reaction?

To make a candle burn, a lit match must first be held to the candlewick. The graph shows the energy changes that happen when a candle is lit and continues to bu

what is the answer to this i need it quick im in a exam. Ernest bought 9/10 of a kilogram of clay for the students in his pottery class. He then divided the cla

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT