robert1122334455 robert1122334455

16-02-2017
Mathematics

contestada

HELP!! PLZ!! I need to get get this right to pass the 6th grade plz help

HELP PLZ I need to get get this right to pass the 6th grade plz help class=

Respuesta :

Аноним Аноним

16-02-2017

23% it shows you what it is right there :)

Answer Link

Faith08 Faith08

16-02-2017

23 percent, your answer would be C.

Hope this helps and good luck!

Answer Link

Otras preguntas

How were the Japanese able to surprise the US at Pearl Harbor?

The line plot shows the measurement of liquids in eight identical beakers. How much total liquid is in all beakers combined? The liquid is measured in millilite

Katie filled a measuring cup with 9/10 of a cup of vegetable oil. Then she poured 1/4 of a cup of the oil into a frying pan. How much oil is left in the measuri

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

What strategy is being used when a person makes the conscious decision not to drink

Contaminemos menos, el calentamiento global continúa siendo un tema preocupante. aunque para que ____ llueva, se reducirá el problema de la sequía. tan pront

what does poe nay sayer have to do with birds

Which best states the moral of the story "The Coyote and the Bear?"Do not be easily fooled.Do not be selfish.Do not forget to relax.Do not forget to appreciate

To what extent does ideological conflict shape our world?

what are some instances in which one should refrain from stretching?