Joitocute Joitocute
  • 13-02-2015
  • Mathematics
contestada

Is .38 greater or less than 3/10

Respuesta :

mali2190
mali2190 mali2190
  • 13-02-2015
.38 is greater because 3/10 is .30 and .38 is greater
Answer Link
Park28Jeny Park28Jeny
  • 13-02-2015
it is greater because if u turn into a decimal it is 38/100 and 3/10 is 30/100
Answer Link

Otras preguntas

The cerebrum is the largest part of the brain. It is divided into 2 parts (halves) called the left and right cerebral hemispheres. The 2 hemispheres are connect
This is a two step question, so can someone answer the first part please?
A person's debt ratio shows the relationship between debt and net worth. the lower the ratio the
A baseball team played 154 regular season games. The ratio of the number of games they won to the number of games they lost was three fourths. How many games di
In the late 1800s the focus of the farmers alliances was to organize
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
The next event requires each runner to jump 8 hurdles that are spaced 12.3 meters apart. If there are 15 meters from the starting line to the first hurdle and
Jenna flips two pennies 105 times. How many times can she expect both coins to come up heads?
Please help!!!! 6x + 3 = ?? when x = 5?? Thanks in advance!!!!!!!!!
In just thomsons experiments with electricity he showed that an electrical current can be