Seudónimo Seudónimo
  • 12-03-2017
  • Chemistry
contestada

Protons size and mass ?

Respuesta :

kailynknight3 kailynknight3
  • 12-03-2017
A proton's mass is 1.6726231*10-27 kg, and the size of its radius is around 0.84×10−15 to 0.87×10−15 m.
Answer Link

Otras preguntas

Though progressive reformers did address the negative effects of industrialization and urbanization, their arguments betray the prejudices of their times. ident
PLEASE ANSWER ASAP! THANK YOU. Which of the following events has a probability closest to 1? A: It will snow in July in Phoenix, Arizona. B: If you roll a die,
Geometry. 8.) what is the value of x ? a. 62 b. 68 c. 124 d. 112
A similarity between the nervous system and the hormone secreting system in humans is that they both...
What happens to the chromosomes during non disjunction
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
The declaration of independence was signed on july 4, 1776, but fighting continued until _______.
In 2003 u.s. soldiers abused iraqi prisoners held at abu ghraib, 20 miles west of baghdad. the prisoners were stripped, made to wear bags over their heads, and
Willow is 63 inches tall. Her brother jayden is 6 feet 5 inches tall. How many inxhes twller is jayden?
what led to increased productivity in the 1920s?