Seudónimo Seudónimo
  • 15-03-2017
  • Mathematics
contestada

what is 16536 divided by 24

Respuesta :

timothydrake
timothydrake timothydrake
  • 15-03-2017
Answer : 16536/24 = 689
Answer Link
Аноним Аноним
  • 15-03-2017
689 is the answer.

I hope this helps. :)
Answer Link

Otras preguntas

Need help with pe question asap pls!
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Given that a car can drive 92 miles with 4 gallons of gasoline, how many gallons does it need to drive 253 miles? 5 gallons 7 gallons 9 gallons 11 gallons
In the sanger (dideoxy) method for dna sequencing, a small amount of a dideoxynucle- otide triphosphate—say, ddctp—is added to the sequencing reaction along wit
A property valued at $295,000 has a gross rent multiplier of 135. What is this property's monthly income? $2,458,$2,185,$2,525 OR $2,328??
The human body uses the breakdown of macronutrients to obtain energy. the nutrients must be converted to (1)___________, which is the form of energy used by the
Calculate the mean and variance of the sample data set provided below. show and explain your steps. round to the nearest tenth. 14, 16, 7, 9, 11, 13, 8, 10
it says A spinner and two cards are shown below help and hurry
According to hetherington's research, the group of divorced individuals known as the ___ had problems before divorce, and these problems increased after the div
Help! I don't know how to graph this reflection