holtormMaramon holtormMaramon
  • 11-04-2017
  • Social Studies
contestada

Which of these is most likely to occur after the government increases taxes?

Respuesta :

meerkat18
meerkat18 meerkat18
  • 24-04-2017
The appropriate response is that consumer spending will diminish. Consumer spending is the acquiring of merchandise and enterprises by people or families. It is the biggest piece of the total request at the macroeconomic level.

I hope it helps. 
Answer Link

Otras preguntas

What is y-5=1/2(x-1) in slope-intercept form?
The overall population of Lithuania has been decreasing in recent years. fact or opinion?
In ΔKLM, k = 890 inches, ∠M=143° and ∠K=34°. Find the length of m, to the nearest 10th of an inch.
can anyone give me the answer to these questions? :)​
1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Perpendicular line from a 90 angle True or false
Chloe measured a city and made a scale drawing. in real life, a neighborhood park is 117 yards long. It is 325 inches long in the drawing. What scale did Chloe
Read the conclusion of The Three Little Pigs, a story about a wolf who tries to break into the houses of three pigs and eat them. When the little Pig saw what h
Find the length of the missing side
Help me pls number 4 I’m giving brainlest