Felix5412 Felix5412

12-04-2017
English

contestada

if Stalin wanted to appear to be a peaceful leader, which audience appeal would most likely be effective?

Respuesta :

plutolover8181 plutolover8181

12-04-2017

Historians I believe would be most entertained with this information

Answer Link

sockmonkey102 sockmonkey102

18-04-2020

Answer: Pathos

Explanation:

Answer Link

Otras preguntas

Write a story problem about 40 apples and 17 pears

Why did conditions of the farmers improve in the years after 1896 despite william jennings bryan’s loss in the election?

What is 0.074¯¯¯¯¯ expressed as a fraction?

a 2.5 x 10^5 is used for 26.4 s to pull a boat straight toward shore how far does the boat move toward shore if a force of 4.2 x 10^4 is applied by the motor

It takes 24 cups of chicken broth to make chicken soup recipe. How much is this in quarts?

What was the reason for creating the Triple Alliance?

How do you find the height of a trapezoid

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

List five rules of golf etiquette. Explain the correct stance, grip, orientation, and parts of a swing.

so if a electronic train is going west what type of train is it going west