nes2sWasTl7uizra nes2sWasTl7uizra
  • 13-04-2017
  • Arts
contestada

Did michelangelo paint the sistine chapel by himself

Respuesta :

roseluxkk
roseluxkk roseluxkk
  • 13-04-2017
He had assistants from time to time, but he mostly did it by himself.
Answer Link
Аноним Аноним
  • 28-02-2022

Answer:

  • Michelangelo was instead commissioned for a cycle of frescoes on the vault and upper walls of the Sistine Chapel. Michelangelo, who was not primarily a painter but a sculptor, was reluctant to take on the work; he suggested that his young rival Raphael take it on instead.

Answer Link

Otras preguntas

According to the geological record, during which geological time period were the sands and clays underlying Long Island and Staten Island deposited?
explain the difference between 10°C and -10°C on a Thermometer​
what is the history of term of abolition​
Clarify the term fair discrimination
if 70kg is 20% of peter's weight, then what is peter's total weight!?​
Question Type your response in the box. Explain the relationship between physical activity, fitness, health, and wellness.
Biological classification is important because it allows scientists to study organisms in a ____ way? A.mnemonic, B.cladistic, C.problematic D.systematic​
Joe has read 80% of a book. He has 6 more pages to finish. How many pages are there in the book?​
please help asap photo attached choices are A. -8 B. -6 C. 0 D. 22
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein