cailynmuglach cailynmuglach

15-05-2017
Chemistry

contestada

What is meant by being a base.
What is the meaning of a hydrogen acceptor

Respuesta :

Аноним Аноним

15-05-2017

my answer -

hydrogen acceptor any substance ( CYTOCHROME OXIDASE) that can become reduced by the addition of hydrogen, thus enabling the transfer and release of energy as in the ELECTRON TRANSPORT SYSTEM.

P.S

Have an AWESOME!!! day :)

Answer Link

Otras preguntas

Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'

A client with chronic obstructive pulmonary disease is admitted to the hospital with a tentative diagnosis of pleuritis. What should the client do when caring f

Explain why the sodium-potassium pump and the proton pump are considered to be electrogenic. Does each pump move equal or unequal numbers of positive and negati

What is a citadel. pls help hurry

A group of six people play the game of \odd person out" to determine who will buy refreshments. Each person ips a fair coin. If there is a person whose outcome

Help me out please!!!!!!!!

For what type(s) of compound do we use Greek, numerical prefixes in the name?

How do you simplify a square root?

Paige Company estimates that unit sales will be 10,000 in quarter 1, 14,000 in quarter 2, 15,000 in quarter 3, and 18,000 in quarter 4. Management desires to ha

How do you know which decmial is greater?