mayjessica16 mayjessica16

12-04-2015
Mathematics

contestada

An amusement park has 20 different rides. You want to ride at least 15 of them. How many different combinations of rides can you go on?

Respuesta :

12-04-2015

There are 15,504 different groups of 15 rides that you can select out of 20 available ones. That's (20 !) / (5! * 15!) .

Answer Link

Otras preguntas

kayla drove 288 km in 4 hours. at this rate how many hours will it take her to drive 432 km?

Ashley receive 2/5 of the amount of donations she requested for school project in the 1st 2 weeks. In the 3rd week she received 2/3 of the amount she received i

A chemist has two large containers of sul- furic acid solution, with different concentrations of acid in each container. Blending 300 mL of the first solution a

10(3x - 8) - 40 =150 What does x equal? Please show your work! Thanks

Vincent has suffered recurrent cold sores since childhood. When finals were over, Vincent and his girlfriend celebrated by going to their favorite romantic spot

Consider the following reaction (assume an ideal gas mixture): 2NOBr(g) 2NO(g) + Br2(g)A 1.0-liter vessel was initially filled with pure NOBr, at a pressure of

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5

What were the goals of the kkk in the south during reconstruction?

Neurotransmission has both electric and chemical components. Explain why both are needed.

Can you use addition to solve a multiplication problem? Yes or no? Explain why or why not