Silvershadow Silvershadow

12-06-2017
Health

contestada

What is the only nutrient you can’t live without?

A) fat
B) protein
C) water
D) carbohydrate

Respuesta :

itsashlynjade itsashlynjade

30-04-2020

Answer:

water! water is very essential, one reason being that it flushes out toxins from the body.

Answer Link

Otras preguntas

Given mn, find the value of x. (x+14)° (9x-4)º

King Lear In these short scenes, we see a renewed focus on Goneril, Regan, and Cordelia, this time not as daughters, but as potential leaders and rulers. In wha

Write the correct equation for the following statement. You decide to rent a limo for prom. The rate is $250 plus $6 per mile traveled. Write an equation to cal

-38 = -3 + 5v solve for v simplify your answer as much as possible

i need help ASAP show your work

11. Which of the following equations best represents the graph below? A. -2x + 3y = 6 C. 3x - 2y = 6 B. 2x + 3y = 6 D. -3x-2y = 6

Uranium-238 is an unstable nuclide that emits an alpha particle, three neutrons, and gamma particles. A = 231 and Z = 90. What daughter nuclide is formed from t

Need Help ASAP please

Which detail from The American Crisis develops the key idea that the failure to face challenges as they arise places the success of future generations at risk?

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.