montezsmith montezsmith

14-06-2017
Physics

contestada

Which of the following does not have a global cycle?

nitrogen
phosphorous
iron
carbon

Respuesta :

st47494 st47494

14-06-2017

the answer is c hope it helps

Answer Link

cavestoryking cavestoryking

22-02-2019

It's Iron, I believe.

Answer Link

Otras preguntas

Question 9 of 10 Mrs. Hall records the heights of 50 students in a spreadsheet. The mean height is 68 inches. After looking at the data again, she realized tha

The u.s. census bureau estimates that 40 percent of u.s. women born in the 1980s will never be married with children. identify the factors that support this pre

What is the net ionic equation for ZnSO4 ?

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

Were women allowed to go to army camps and war in ww1 , why or why not? And give some information about the army camps in ww1

BRAINLIEST+5 STARS Read each sentence and place it under the appropriate label.

Is -5 5/6 greater than -5.8

In one study, participants saw a video of a car wreck and were then asked questions about what they had seen. participants who heard the question, "how fast wer

1. In the play Trifles, what characterization is likely revealed by the following stage directions? The women have come in slowly, and stand close together near

PLEASE ANSWER + BRAINLIEST !!!! Part A: As it is used in this paragraph, the word “compels” most nearly means: A. Urges B. Pains C. Desires D. Prevents Part B: