brandoned67 brandoned67
  • 14-07-2017
  • Mathematics
contestada

If CX = 5 units, then DZ = __units.

If CX 5 units then DZ units class=

Respuesta :

choixongdong
choixongdong choixongdong
  • 14-07-2017
Let's DZ = x

25/5 = 20/x
25x = 100
x = 4
answer
DZ = 4
Answer Link
musiclover10045
musiclover10045 musiclover10045
  • 14-07-2017

need to do a ratio

25/20 = 5/x

20*5 = 100

x=100/25 = 4

DZ = 4 units

Answer Link

Otras preguntas

Which of the following is not expressions of impulse
Which of the following is an example of a metamorphic rock? Granite limestone marble pumice WILL MARK BRAINLIEST IF CORRECT HURRY
How do you use VMware Fusion to make a Tip Calculator?
The amount $180.00 is what percent greater than $135.00? A. 35% B. 133.33% C. 33.33% D. 25% Mark for review (Will be highlighted on the re
What was an effect of peaceful protests organized by Martin Luther King Jr.? A. The violence used by segregationists against the protests was shown across th
Subtract (12x+9) from the sum of (5x^2+8x+6) and (8x^2+6x-6)
You push a 4.9 kg block against a horizontal spring, compressing the spring by 16 cm. then you release the block, and the spring sends it sliding across a table
A particle moving in the x direction is being acted upon by a net force f(x)=cx2, for some constant c. the particle moves from xinitial=l to xfinal=3l. what is
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
Which statement best describes the way that relationships can progress to violence